rs3752228 chr19:1041165 C>T
- Sequence
ggttgcgctcccattggtttactc[C/T]acccctggggtagcggagcctctt
- ASB in cell types
- BJAB (Burkitt lymphoma)
- ASB for transcription factors
- SPT5H_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SPT5H_HUMAN | 2.28 | -1.98 | 1.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, advanced age-related macular degeneration (geographic atrophy), diastolic blood pressure (dbp), homa-ir, microalbuminuria, primary rhegmatogenous retinal detachment, salmonella-induced pyroptosis