rs3752608 chr1:167834585 G>T
- Sequence
ccctgcacaactctcatcacttca[G/T]cttcacctcccaacatcattaggc
- ASB in cell types
- CTV-1 (Adult T acute lymphoblastic leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| CTV-1 (Adult T acute lymphoblastic leukemia) | 1.12 | 0.05 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP campthothecin-induced neutropenia/leukopenia in cancer patients, hdl cholesterol, homa-ir, waist hip ratio