rs3752789 chr6:69797227 T>C
- Sequence
ttgagatatttgactcagcctaag[T/C]tgatagactagaacagcaagggaa
- ASB in cell types
- foreskin keratinocyte K562 (myelogenous leukemia) GM12878 (female B-cells lymphoblastoid cell line) H929 (plasma cell myeloma)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | 1.11 | n/a | 2.67 | |||
| K562 (myelogenous leukemia) | 0.77 | 0.23 | 2.07 | |||
| GM12878 (female B-cells lymphoblastoid cell line) | 0.63 | 0.82 | 1.11 | |||
| H929 (plasma cell myeloma) | 2.17 | -1.74 | 1.00 |
Items per page:
1 – 4 of 4
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Artery_Aorta, Brain_Cerebellum, Brain_Cortex, Brain_Hypothalamus, Brain_Nucleus_accumbens_basal_ganglia, Cells_Cultured_fibroblasts, Esophagus_Mucosa, Lung, Muscle_Skeletal, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis