rs3752974 chr13:98445573 T>C
- Sequence
gccccacttcctgggtagggtgcc[T/C]ggcccctcaaaacgagtgctgctc
- ASB in cell types
- foreskin keratinocyte GM17942 (lymphoblastoid cell)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | n/a | 1.09 | 2.33 | |||
| GM17942 (lymphoblastoid cell) | 0.64 | -0.64 | 1.00 |
Items per page:
1 – 2 of 2