rs3753404 chr1:54801543 G>A
- Sequence
aagagaacttgcccaggtcacaga[G/A]ctggggcgtacccaagtaggtaga
- ASB in cell types
- foreskin keratinocyte GM02255 (Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | 1.14 | n/a | 2.50 | |||
| GM02255 (Lymphoblastoid Cell Lines) | 0.73 | -0.20 | 1.00 |
Items per page:
1 – 2 of 2