rs3753692 chr1:28736301 T>G
- Sequence
aaataaattgtagattctccttcc[T/G]gcaatgctaaggggtgaatctctt
- ASB in cell types
- MS-1 (Small cell lung carcinoma) GM12878 (female B-cells lymphoblastoid cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MS-1 (Small cell lung carcinoma) | -1.34 | 1.67 | 1.00 | |||
| GM12878 (female B-cells lymphoblastoid cell line) | 0.66 | 0.68 | 1.02 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP body mass index (bmi), comorbid depressive syndrome and alcohol dependence, diastolic blood pressure (dbp), obesity with early age of onset (age >2), systolic blood pressure (sbp), urinary albumin-to-creatinine ratio
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Tibial, Brain_Caudate_basal_ganglia, Brain_Cerebellum, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Lung, Nerve_Tibial, Small_Intestine_Terminal_Ileum, Spleen, Thyroid, Whole_Blood