rs3754104 chr1:117100373 C>G
- Sequence
tcccatgcccactgccaggtcccc[C/G]cttcccactctgctgaatcctgtt
- ASB in cell types
- HEK293T (embryonic kidney)
- ASB for transcription factors
- PRDM9_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| PRDM9_HUMAN | 2.65 | n/a | 1.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, infant head circumference, ldl cholesterol change with statins, triglycerides change with statins
GTEx eQTL Artery_Aorta, Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Cortex, Brain_Hypothalamus, Cells_Cultured_fibroblasts, Esophagus_Muscularis, Heart_Left_Ventricle, Spleen, Stomach, Testis, Thyroid, Whole_Blood