rs3754552 chr2:46542063 T>C
- Sequence
tcaacacgctgtatctcccttagt[T/C]accggtttcatagtaaatgattaa
- ASB in cell types
- GM12890 (Lymphoblastoid Cell Lines) RWPE1 (prostate epithelial cells)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12890 (Lymphoblastoid Cell Lines) | -0.56 | 1.20 | 1.00 | |||
| RWPE1 (prostate epithelial cells) | -2.06 | 2.44 | 1.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP aortic valve calcium, diastolic blood pressure (dbp), simpson-angus scale, systolic blood pressure (sbp)
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Tibial, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Sigmoid, Esophagus_Muscularis, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Testis, Thyroid