rs3754835 chr2:31980960 T>G
- Sequence
tcagcagcaagagttctatacaaa[T/G]taaacgtggtgactagataaacta
- ASB in cell types
- A549 (lung carcinoma) GM12878 (female B-cells lymphoblastoid cell line)
- ASB for transcription factors
- RFX5_HUMAN FOXK2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| RFX5_HUMAN | 0.28 | 1.32 | 1.67 | n/a | No Hit | |||
| FOXK2_HUMAN | -5.04 | 3.06 | 1.50 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (geographic atrophy), college completion, cystatin c in serum, fasting insulin, hdl cholesterol, homa-b, homa-ir, ldl cholesterol, obesity with early age of onset (age >2), parkinsons disease, premature ovarian failure, total cholesterol
GTEx eQTL Adipose_Subcutaneous, Artery_Aorta, Cells_Cultured_fibroblasts, Esophagus_Gastroesophageal_Junction, Lung, Muscle_Skeletal, Nerve_Tibial, Pituitary, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid, Whole_Blood