rs3754876 chr2:98569404 C>T
- Sequence
ccacagccactagggggcgccacg[C/T]gtcagaaggtatcatcccctctgt
- ASB in cell types
- CD34+ stem cells-derived erythroblasts sigmoid colon
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| CD34+ stem cells-derived erythroblasts | 2.00 | -4.68 | 2.00 | |||
| sigmoid colon | -1.62 | 2.01 | 1.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP aortic valve calcium, bipolar disorder, height, nonsyndromic striae distensae (stretch marks), primary sclerosing cholangitis and ulcerative colitis, prop taste detection threshold, stabilized warfarin dose, tetrology of fallot
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Brain_Cerebellum, Brain_Cortex, Cells_Cultured_fibroblasts, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Liver, Lung, Muscle_Skeletal, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Stomach, Testis, Thyroid