rs3755482 chr2:102006356 A>G
- Sequence
aactcgtgaagaatagtattgtgt[A/G]gaaacagagtttaagggagaaagc
- ASB in cell types
- A549 (lung carcinoma) CD34+ stem cells-derived erythroblasts
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| A549 (lung carcinoma) | -0.01 | 0.90 | 2.03 | |||
| CD34+ stem cells-derived erythroblasts | 1.87 | -0.90 | 2.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Cells_Cultured_fibroblasts, Esophagus_Mucosa, Esophagus_Muscularis, Liver, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis