rs3755996 chr4:139656766 C>A
- Sequence
tctcacccctcctctatcccctcg[C/A]agtttgccacagggatgccaaacg
- ASB in cell types
- pancreas GM19193 (female B-cells Lymphoblastoid Cell Lines) adrenal gland Peyer's patch
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 0.31 | 1.97 | 1.41 | n/a | No Hit |
Items per page:
1 – 1 of 1