rs3756353 chr5:100903483 C>T
- Sequence
cacatacatacatatgcacacaca[C/T]gtacacgcagaatcacacacactc
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) CTV-1 (Adult T acute lymphoblastic leukemia) CD14+ monocytes
- ASB for transcription factors
- ETS1_HUMAN KDM1A_HUMAN STAT1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ETS1_HUMAN | -0.78 | 1.93 | 1.00 | n/a | No Hit | |||
| KDM1A_HUMAN | 2.88 | -5.39 | 2.00 | n/a | n/a | |||
| STAT1_HUMAN | 1.48 | -0.35 | 1.50 | n/a | No Hit |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GRASP comorbid depressive syndrome and alcohol dependence, cystatin c in serum, homa-b, homa-ir, ldl cholesterol, ldl cholesterol change with statins, total cholesterol, years of education