rs3756354 chr5:100903829 G>C
- Sequence
acacacatgaacctgttagccgat[G/C]ggcccactctgcatgggtggtgga
- ASB in cell types
- CD14+ monocytes GM12878 (female B-cells lymphoblastoid cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| CD14+ monocytes | 2.21 | -4.44 | 2.00 | |||
| GM12878 (female B-cells lymphoblastoid cell line) | 0.70 | 0.90 | 1.06 |
Items per page:
1 – 2 of 2