rs3756645 chr5:154401669 A>C
- Sequence
gcatttctccaggcagcacttcca[A/C]taattgcagccctgtgcacatccc
- ASB in cell types
- BE2C
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| BE2C | -1.78 | 1.97 | 1.50 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP college completion, diastolic blood pressure (dbp), premature ovarian failure, years of education