rs3756975 chr6:132715374 T>C
- Sequence
tcaagcagctgccagggctagcta[T/C]atcaaggcttgactccaggaggat
- ASB in cell types
- HMEC (human mammary epithelial cells) pancreas TTC-1240 (Rhabdoid tumor of the kidney)
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 1.31 | 0.40 | 1.27 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP diabetic retinopathy in type 2 diabetes mellitus, hdl cholesterol, homa-ir, hypertension (early onset hypertension), neuroblastoma (brain cancer)