rs3757444 chr7:12685841 C>A
- Sequence
aatgtgtgcaagacatgcgaaaac[C/A]accaccattaacactgaagatgtg
- ASB in cell types
- GM19193 (female B-cells Lymphoblastoid Cell Lines) GM19238 (female B-cells lymphoblastoid cell lines)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM19193 (female B-cells Lymphoblastoid Cell Lines) | 2.74 | n/a | 1.00 | |||
| GM19238 (female B-cells lymphoblastoid cell lines) | 1.87 | -3.23 | 1.33 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP birth weight, body mass index (bmi), cystatin c in serum, hdl cholesterol, obesity (body mass index (bmi)), triglycerides