rs3757649 chr7:111742216 G>A
- Sequence
gctatgggccgagcactttactac[G/A]catttcgcttgcattattgctaat
- ASB in cell types
- K562 (myelogenous leukemia) GM12891 (male B- cells lymphoblastoid cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 1.84 | -1.38 | 1.50 | |||
| GM12891 (male B- cells lymphoblastoid cell line) | -0.23 | 1.35 | 1.00 |
Items per page:
1 – 2 of 2