rs3757793 chr7:127585726 G>A
- Sequence
ctgttgagaacgcagtggggccgc[G/A]agcggcaaaaaacaggcttgggaa
- ASB in cell types
- HEK293 (embryonic kidney) HCASMC (Human coronary artery smooth muscle cells)
- ASB for transcription factors
- ENL_HUMAN JUND_HUMAN MED26_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ENL_HUMAN | 3.00 | -2.73 | 1.00 | n/a | n/a | |||
| JUND_HUMAN | 2.47 | n/a | 1.00 | n/a | No Hit | |||
| MED26_HUMAN | 1.55 | -1.78 | 1.00 | n/a | n/a |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Visceral_Omentum, Artery_Aorta, Artery_Tibial, Brain_Spinal_cord_cervical_c-1, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Lung, Muscle_Skeletal, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Thyroid