rs3758139 chr8:6928698 C>G
- Sequence
tatcttccagtaaagaagaacctg[C/G]ccttacagagaactgggcgcgcag
- ASB in cell types
- foreskin keratinocyte GM02255 (Lymphoblastoid Cell Lines) GM18526 (B – cells Lymphoblastoid Cell Lines)
- ASB for transcription factors
- STAG1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| STAG1_HUMAN | -0.59 | 1.30 | 1.11 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, ldl cholesterol, obesity with early age of onset (age >2), total cholesterol