rs3758231 chr9:92293914 T>G
- Sequence
gaaccagcgctgagggcggcgctg[T/G]gcgtgctgcttgtatccgttgcag
- ASB in cell types
- epithelial cell of prostate MOLT-4 (Adult T acute lymphoblastic leukemia) monocytes from periferal blood heart left ventricle
- ASB for transcription factors
- CTCF_HUMAN SRBP2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 1.54 | 0.28 | 1.17 | n/a | No Hit | |||
| SRBP2_HUMAN | 2.40 | n/a | 3.00 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Artery_Tibial, Brain_Cerebellum, Cells_Cultured_fibroblasts, Heart_Left_Ventricle, Nerve_Tibial, Testis, Whole_Blood