rs3758269 chr9:33403642 G>A
- Sequence
ttctgcagatctttctgcaggggt[G/A]aggcagggagaggaaggggtcggc
- ASB in cell types
- foreskin keratinocyte GM12891 (male B- cells lymphoblastoid cell line) GM12890 (Lymphoblastoid Cell Lines)
- ASB for transcription factors
- CTCF_HUMAN STAG1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 1.18 | 0.19 | 1.39 | n/a | No Hit | |||
| STAG1_HUMAN | 0.86 | -0.69 | 1.17 | n/a | n/a |
Items per page:
1 – 2 of 2