rs3758317 chr9:84667700 C>T
- Sequence
cactagggcgaaaatgggccgttt[C/T]ttagaaaaatgggctcagagtatg
- ASB in cell types
- GM02610 (Lymphoblastoid Cell Lines) 22RV1 (prostate carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM02610 (Lymphoblastoid Cell Lines) | 1.40 | -1.40 | 1.00 | |||
| 22RV1 (prostate carcinoma) | -1.49 | 2.20 | 1.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP alzheimers disease (apoe4 homozygotes), arthritis including non-rheumatoid, longstanding arthritis, rheumatoid arthritis