rs3758354 chr9:73149649 A>C
- Sequence
ttgtaaagtaagtggagccgatga[A/C]tcatcatcttctagaaacagcaag
- ASB in cell types
- CD14+ monocytes
- ASB for transcription factors
- STAT1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| STAT1_HUMAN | 3.26 | n/a | 2.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP barnes akathisia rating scale, biploar disorder (bipolar ii disorder), height, transmission distortion
PheWAS absent or infrequent menstruation, angiodysplasia of intestine, cellulitis and abscess of leg, cellulitis and abscess of trunk, chronic glomerulonephritis, coagulation defects, colostomy and enterostomy complication, derangement of joint, non-traumatic, deviated nasal septum, digestive congenital anomalies, disorders of liver, dyspepsia and disorders of function of stomach, endometriosis, fracture of clavicle or scapula, gangrene, hypertensive heart disease, keratoconjunctivitis, noninfectious, megaloblastic anemia, myeloid leukemia, neuralgia, neuritis, and radiculitis nos, nonsenile cataract, obstructive chronic bronchitis, osteoarthrosis, localized, secondary, osteopenia, other acute and subacute forms of ischemic heart disease, other disorders of middle ear and mastoid, otorrhea, pathologic fracture of vertebrae, pernicious or b12 deficiency anemia, posterior pituitary disorders, secondary malignancy of lung, skin neoplasm of uncertain behavior, spondylosis with myelopathy, streptococcus infection, thyroiditis, urinary obstruction