rs3758365 chr10:28676844 C>G
- Sequence
aattttcgttaagtgtctctagcc[C/G]gctactcgtcccgcgtacccggga
- ASB in cell types
- HS-SY-2(Monophasic synovial sarcoma) LNCaP C4-2B (prostate carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HS-SY-2(Monophasic synovial sarcoma) | 1.02 | -0.35 | 2.86 | |||
| LNCaP C4-2B (prostate carcinoma) | 0.26 | 2.49 | 1.00 |
Items per page:
1 – 2 of 2