rs3758398 chr10:44981632 T>C
- Sequence
ctgcggctctgggtagagggcagc[T/C]gaggttgctggcaagtattctggc
- ASB in cell types
- BEAS-2B (bronchial epithelium) epithelial cell of prostate
- ASB for transcription factors
- GCR_HUMAN CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| GCR_HUMAN | 0.89 | 1.11 | 1.00 | n/a | No Hit | |||
| CTCF_HUMAN | -0.64 | 1.97 | 1.12 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Artery_Tibial, Brain_Cortex, Colon_Transverse, Esophagus_Mucosa, Esophagus_Muscularis, Lung, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Whole_Blood