rs3759082 chr12:45216994 A>T
- Sequence
gaggaggaattcccccaggcaggg[A/T]ggaccgcagggcctttttcactcg
- ASB in cell types
- K562 (myelogenous leukemia) GM19238 (female B-cells lymphoblastoid cell lines)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.88 | -0.03 | 2.02 | |||
| GM19238 (female B-cells lymphoblastoid cell lines) | 1.19 | -0.44 | 1.00 |
Items per page:
1 – 2 of 2