rs3759345 chr12:6753512 G>T
- Sequence
gatgccccttggggagaggcgggc[G/T]ctctgtgggcgacgaggcggggcg
- ASB in cell types
- GM02630 (Fanconi anemi) GM02255 (Lymphoblastoid Cell Lines) neural cell BEAS-2B (bronchial epithelium)
- ASB for transcription factors
- STAG1_HUMAN GCR_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| STAG1_HUMAN | -0.19 | 1.92 | 1.00 | n/a | n/a | |||
| GCR_HUMAN | 1.54 | 0.50 | 1.00 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP 2 hour glucose, advanced age-related macular degeneration, diastolic blood pressure (dbp), hdl cholesterol, ldl cholesterol, total cholesterol change with statins, triglycerides
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Tibial, Breast_Mammary_Tissue, Esophagus_Mucosa, Esophagus_Muscularis, Nerve_Tibial, Spleen, Thyroid, Whole_Blood