rs3759416 chr12:7131050 G>A
- Sequence
tcgggtctgggaaggactgccccc[G/A]agccggtgataggcctctccccgc
- ASB in cell types
- HEK293 (embryonic kidney) HT1080 (fibrosarcoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | 0.21 | 0.86 | 2.02 | |||
| HT1080 (fibrosarcoma) | 2.42 | -0.22 | 1.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Tibial, Esophagus_Muscularis, Lung, Nerve_Tibial, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Thyroid, Whole_Blood