rs3759548 chr14:34981127 C>T
- Sequence
gcagtgagctggatggcgccactg[C/T]agccccgcctgggcaacaagagtg
- ASB in cell types
- HepG2 (hepatoblastoma) monocytes from periferal blood GM12878 (female B-cells lymphoblastoid cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HepG2 (hepatoblastoma) | 0.72 | 0.25 | 1.92 | |||
| monocytes from periferal blood | 2.37 | n/a | 3.00 | |||
| GM12878 (female B-cells lymphoblastoid cell line) | 1.55 | -0.59 | 2.00 |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Brain_Cortex, Cells_Cultured_fibroblasts, Colon_Transverse, Esophagus_Mucosa, Esophagus_Muscularis, Muscle_Skeletal, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Testis, Whole_Blood