rs3760224 chr17:67718116 C>G
- Sequence
aaggcaataggtttgggagcgccc[C/G]gactgccttctcgcccctttctga
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma) primary B-CLL cells GM19239 (male B-cells lymphoblastoid cell line)
- ASB for transcription factors
- MNT_HUMAN MTA1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| MNT_HUMAN | -2.03 | 2.42 | 1.00 | n/a | No Hit | |||
| MTA1_HUMAN | n/a | 2.84 | 1.00 | n/a | n/a |
Items per page:
1 – 2 of 2