rs3760776 chr19:5839735 G>A
- Sequence
atgatctggaatactggttttgag[G/A]gaggatgaccttaaactctctcac
- ASB in cell types
- monocyte-derived dendritic cells
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| monocyte-derived dendritic cells | 2.40 | -1.43 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (geographic atrophy), antennary fucosylated glycans, antennary fucosylated glycans in men, antennary fucosylated glycans in women, bipolar disorder, desialylated glycan peak 12, desialylated glycan peak 12 in women, desialylated glycan peak 7, desialylated glycan peak 7 in men, desialylated glycan peak 7 in women, desialylated glycan peak 9, desialylated glycan peak 9 in men, desialylated glycan peak 9 in women, esophageal squamous cell carcinoma (esophageal cancer), eye color, fasting blood glucose, glycan peak 14, glycan peak 14 in men, glycan peak 14 in women, late onset alzheimers disease, maternal transmission distortion, plasma cancer antigen 19-9 (ca19-9) levels, plasma carcinoembryonic antigen (cea) levels, plasma n-glycan levels (dg10), plasma n-glycan levels (dg11), plasma n-glycan levels (dg12), plasma n-glycan levels (dg7), plasma n-glycan levels (dg8), plasma n-glycan levels (dg9), plasma n-glycan levels (fuc-a), schizophrenia, serum vitamin b12 level, spine bone mineral density (bmd)
PheWAS abnormal findings on radiological exam of musculoskeletal system, acquired toe deformities, allergy/adverse effect of penicillin, anomalies of tooth position/malocclusion, bacteremia, benign neoplasm of other parts of digestive system, bladder neck obstruction, bullous dermatoses, calcium/phosphorus disorders, choroidal degenerations, conduct disorders, congenital anomalies of posterior segment of eye, congenital anomalies of the eye, cornea replaced by transplant, cyst and pseudocyst of pancreas, dentofacial anomalies, including malocclusion, disorders of choroid, disorders of menstruation, disorders of sacrum, elevated blood pressure reading, encounter for long-term use of aspirin, essential hypertension, excessive or frequent menstruation, frequency of urination and polyuria, generalized hyperhidrosis, hemiplegia, herpes simplex, hypercoagulable state, hypertension, hypertensive chronic kidney disease, inflammatory disease of breast, intestinal malabsorption, iron deficiency anemia secondary to blood loss, irregular menstrual cycle/bleeding, jaw disease nos, large cell lymphoma, muscular dystrophies and other myopathies, myalgia and myositis nos, nonallopathic lesions nec, noninfectious gastroenteritis, other disorders of bladder, other disorders of stomach and duodenum, other hypertensive complications, other sprains and strains, persistent mental disorders due to other conditions, prolapse of vaginal vault after hysterectomy, prolapse of vaginal walls, renal colic, renal dialysis, renal failure, retinal hemorrhage/ischemia, seborrheic keratosis, skin neoplasm of uncertain behavior, stomach cancer, strabismus (not specified as paralytic), subjective visual disturbances, symptoms/disorders of the urinary system, temporomandibular joint disorders, vaginal enterocele, congenital or acquired