rs3760898 chr19:3988273 T>G
- Sequence
cgtgatctgcccgccttggcctcc[T/G]aaagcgctgggattacaggcgtga
- ASB in cell types
- K562 (myelogenous leukemia) primary B-CLL cells
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.65 | 0.09 | 2.00 | |||
| primary B-CLL cells | 2.24 | n/a | 3.00 |
Items per page:
1 – 2 of 2