rs3760899 chr19:3988330 A>G
- Sequence
gcccggccaacactgtcttttaac[A/G]gtttattgagcgtttactaggacc
- ASB in cell types
- HEK293 (embryonic kidney) 22RV1 (prostate carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | -0.03 | 0.77 | 2.00 | |||
| 22RV1 (prostate carcinoma) | 1.45 | -0.08 | 1.50 |
Items per page:
1 – 2 of 2