rs3760912 chr19:13152524 C>T
- Sequence
gaaggaagcagatagaacagtatc[C/T]tccgaggagtggaggctggggatc
- ASB in cell types
- HEK293 (embryonic kidney) K562 (myelogenous leukemia) 22RV1 (prostate carcinoma) GM12878 (female B-cells lymphoblastoid cell line)
- ASB for transcription factors
- ANDR_HUMAN ZFHX2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ANDR_HUMAN | 2.56 | 0.13 | 2.00 | 4.71 | Discordant | |||
| ZFHX2_HUMAN | -4.65 | 2.55 | 2.00 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
Genetic associations
GRASP adiponectin levels, arthritis including non-rheumatoid, birth weight, body mass index (bmi), comorbid depressive syndrome and alcohol dependence, cystatin c in serum, diastolic blood pressure (dbp), longstanding arthritis, tetrology of fallot, total cholesterol