rs3761203 chr20:57106140 G>T
- Sequence
gaaaatcccacccatgctggctta[G/T]ggaaggacaagggaggatttttct
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma)
- ASB for transcription factors
- CLOCK_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CLOCK_HUMAN | n/a | 2.47 | 5.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP age at death with kuru exposure, anti-tnf treatment response in rheumatoid arthritis (by das-28 score change at 3 months), birth weight, chronic kidney disease, fasting blood glucose, irritible bowel syndrome, late onset alzheimers disease, microalbuminuria, stabilized warfarin dose, variant creutzfeldt-jakob disease