rs3761445 chr22:38199404 G>A
- Sequence
atttgcataccaaacccacagcct[G/A]tgggagggaacggaaagaagccat
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) CD14+ monocytes
- ASB for transcription factors
- SRF_HUMAN IKZF2_HUMAN IKZF1_HUMAN SKIL_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SRF_HUMAN | 2.43 | -2.24 | 1.00 | n/a | No Hit | |||
| IKZF2_HUMAN | 2.08 | -2.92 | 1.50 | n/a | n/a | |||
| IKZF1_HUMAN | 1.78 | -1.77 | 1.94 | n/a | n/a | |||
| SKIL_HUMAN | 3.01 | -2.88 | 1.00 | n/a | n/a | |||
| RELB_HUMAN | 2.47 | n/a | 1.00 | n/a | No Hit |
Items per page:
1 – 5 of 9
Motif analysis
No data available
Genetic associations
GRASP arthritis including non-rheumatoid, autism with low iq, birth weight, body mass index (bmi), chronic kidney disease, hdl cholesterol, height, infant head circumference, ldl cholesterol, myopia, serum creatinine, total cholesterol, triglycerides
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Coronary, Artery_Tibial, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Lung, Nerve_Tibial, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Thyroid