rs3761446 chr22:38199476 G>A
- Sequence
gaggcaggaaagcaagacaagggc[G/A]ctgaaatcgaatttgctacatcaa
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line)
- ASB for transcription factors
- SRF_HUMAN IKZF2_HUMAN IKZF1_HUMAN NFAC3_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SRF_HUMAN | -1.96 | 2.27 | 1.00 | n/a | No Hit | |||
| IKZF2_HUMAN | -2.83 | 2.02 | 1.50 | n/a | n/a | |||
| IKZF1_HUMAN | -3.45 | 1.98 | 1.83 | n/a | n/a | |||
| NFAC3_HUMAN | n/a | 2.59 | 1.00 | n/a | No Hit | |||
| SKIL_HUMAN | n/a | 2.49 | 1.00 | n/a | n/a |
Items per page:
1 – 5 of 6
Motif analysis
No data available
Genetic associations
GRASP birth weight, body mass index (bmi), hdl cholesterol, height, infant head circumference, ldl cholesterol, total cholesterol, triglycerides
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Tibial, Brain_Cerebellar_Hemisphere, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Lung, Nerve_Tibial, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Thyroid, Whole_Blood