rs3761757 chr5:142108654 A>C
- Sequence
tcaggtcgtcggagcaactacacc[A/C]gggccggtgcacctcggggcggcg
- ASB in cell types
- K562 (myelogenous leukemia) upper lobe of left lung CAR-T cells 22RV1 (prostate carcinoma)
- ASB for transcription factors
- IRF4_HUMAN CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| IRF4_HUMAN | -1.51 | 1.82 | 1.00 | n/a | No Hit | |||
| CTCF_HUMAN | 0.97 | 1.09 | 1.14 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Artery_Tibial, Brain_Putamen_basal_ganglia, Cells_EBV-transformed_lymphocytes, Heart_Atrial_Appendage, Heart_Left_Ventricle, Muscle_Skeletal, Skin_Not_Sun_Exposed_Suprapubic, Thyroid