rs3761758 chr5:142108794 G>T
- Sequence
ctcttccccaggggccgcgtcgga[G/T]cctcggcggcggcggcggtgctta
- ASB in cell types
- K562 (myelogenous leukemia) 22RV1 (prostate carcinoma) breast tumor tibial nerve
- ASB for transcription factors
- ANDR_HUMAN ESR1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ANDR_HUMAN | 2.92 | 0.21 | 1.75 | n/a | No Hit | |||
| ESR1_HUMAN | 2.00 | 0.33 | 2.00 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Hippocampus, Brain_Putamen_basal_ganglia, Heart_Atrial_Appendage, Muscle_Skeletal, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Thyroid