rs3761931 chr1:113614401 G>A
- Sequence
ttgtttaatgccatcttctgttct[G/A]ggcttctgattgcttgctgaaatt
- ASB for transcription factors
- P53_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| P53_HUMAN | 3.16 | n/a | 2.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP acute lung injury following major trauma, adiponectin levels, cervical cancer, panic disorder, prop taste detection threshold, rheumatoid arthritis, triglycerides change with statins, urinary albumin-to-creatinine ratio
GTEx eQTL Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Cells_Cultured_fibroblasts, Colon_Transverse, Esophagus_Muscularis, Muscle_Skeletal, Nerve_Tibial, Pancreas, Stomach, Testis, Thyroid