rs3763197 chr6:163417980 T>C
- Sequence
tattggtttctgaagtccatcaca[T/C]ttttttttctggatgatttaattg
- ASB in cell types
- K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.82 | 0.57 | 1.02 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP adiponectin levels, advanced age-related macular degeneration (geographic atrophy), alzheimers disease, arthritis including non-rheumatoid, asthma, bipolar disorder, body mass index (bmi), irritible bowel syndrome, longstanding arthritis, waist hip ratio