rs3763504 chr7:48089304 T>C
- Sequence
cgcacagacccgcgccccgccgtc[T/C]gcgagcctcccgagagccgtccct
- ASB in cell types
- K562 (myelogenous leukemia) HT29 (colon adenocarcinoma) HCC1806(Squamous cell breast carcinoma, acantholytic variant)
- ASB for transcription factors
- NR1H3_HUMAN NELFE_HUMAN ZN366_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| NR1H3_HUMAN | 2.50 | -1.23 | 1.00 | n/a | No Hit | |||
| NELFE_HUMAN | -1.86 | 2.42 | 2.00 | n/a | n/a | |||
| ZN366_HUMAN | -2.24 | 2.60 | 1.00 | n/a | n/a |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GTEx eQTL Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Cells_Cultured_fibroblasts, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Left_Ventricle, Liver, Muscle_Skeletal, Nerve_Tibial, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid, Whole_Blood