rs3763610 chr9:137578936 T>G
- Sequence
cctctctcgcgactccttccgggg[T/G]gccggggcgggacatccggcaggg
- ASB in cell types
- HepG2 (hepatoblastoma) CD14+ monocytes erythroid cells foreskin keratinocyte
- ASB for transcription factors
- STAT1_HUMAN GABP1_HUMAN GABPA_HUMAN FOXK2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| STAT1_HUMAN | 3.50 | -0.39 | 1.75 | n/a | No Hit | |||
| GABP1_HUMAN | 2.16 | -2.16 | 1.00 | n/a | n/a | |||
| GABPA_HUMAN | 0.95 | -0.93 | 1.42 | n/a | No Hit | |||
| FOXK2_HUMAN | 2.96 | 0.11 | 1.00 | n/a | No Hit | |||
| BC11B_HUMAN | 2.98 | n/a | 3.50 | n/a | n/a |
Items per page:
1 – 5 of 6
Motif analysis
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Aorta, Artery_Coronary, Artery_Tibial, Brain_Caudate_basal_ganglia, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Cortex, Brain_Hippocampus, Brain_Hypothalamus, Brain_Nucleus_accumbens_basal_ganglia, Brain_Spinal_cord_cervical_c-1, Brain_Substantia_nigra, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Liver, Lung, Muscle_Skeletal, Nerve_Tibial, Ovary, Pancreas, Pituitary, Prostate, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Small_Intestine_Terminal_Ileum, Spleen, Stomach, Testis, Thyroid, Whole_Blood