rs3763814 chr11:82901800 C>G
- Sequence
cgagtcactgtgcgtcgcctgggc[C/G]cgttcctggtcttctcccccaggt
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) HCC1806(Squamous cell breast carcinoma, acantholytic variant) HepG2 (hepatoblastoma) MDA-MB-231p27CK-DD (breast cancer cells, phosphimimetic p27 cell line)
- ASB for transcription factors
- FOXK2_HUMAN BRD2_HUMAN SMC3_HUMAN SP130_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| FOXK2_HUMAN | 3.03 | -0.09 | 1.25 | n/a | No Hit | |||
| BRD2_HUMAN | 1.51 | -0.24 | 1.33 | n/a | n/a | |||
| SMC3_HUMAN | 2.25 | -1.91 | 1.00 | n/a | n/a | |||
| SP130_HUMAN | -1.57 | 1.57 | 1.00 | n/a | n/a | |||
| SMCA4_HUMAN | 1.34 | -0.60 | 1.00 | n/a | n/a |
Items per page:
1 – 5 of 6
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Cells_EBV-transformed_lymphocytes, Colon_Sigmoid, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Liver, Muscle_Skeletal, Nerve_Tibial, Ovary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid, Whole_Blood