rs3764262 chr16:56931819 G>C
- Sequence
aggataccccactccccaccccct[G/C]cctcgggcgccctcagccacccga
- ASB in cell types
- K562 (myelogenous leukemia) HepG2 (hepatoblastoma)
- ASB for transcription factors
- RFOX2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| RFOX2_HUMAN | 2.29 | -0.66 | 1.83 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Tibial, Cells_Cultured_fibroblasts, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Left_Ventricle, Lung, Skin_Not_Sun_Exposed_Suprapubic