rs3764509 chr18:74499889 C>G
- Sequence
acgtgctttctgggcaggtcgccc[C/G]tcagtctccactagagacaggact
- ASB in cell types
- K562 (myelogenous leukemia) liver 22RV1 (prostate carcinoma)
- ASB for transcription factors
- RFX1_HUMAN MEIS2_HUMAN MNT_HUMAN HDAC1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| RFX1_HUMAN | -2.83 | 2.60 | 2.00 | n/a | No Hit | |||
| MEIS2_HUMAN | n/a | 3.07 | 1.00 | 3.46 | Concordant | |||
| MNT_HUMAN | -0.69 | 1.63 | 1.22 | n/a | No Hit | |||
| HDAC1_HUMAN | 1.16 | 2.62 | 1.00 | n/a | n/a | |||
| E4F1_HUMAN | -2.61 | 2.85 | 1.00 | n/a | No Hit |
Items per page:
1 – 5 of 10
Motif analysis
Genetic associations
GTEx eQTL Adipose_Visceral_Omentum, Brain_Amygdala, Brain_Anterior_cingulate_cortex_BA24, Brain_Caudate_basal_ganglia, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Cortex, Brain_Frontal_Cortex_BA9, Brain_Hippocampus, Brain_Hypothalamus, Brain_Nucleus_accumbens_basal_ganglia, Brain_Putamen_basal_ganglia, Brain_Substantia_nigra, Cells_Cultured_fibroblasts, Cells_EBV-transformed_lymphocytes, Esophagus_Mucosa, Heart_Atrial_Appendage, Muscle_Skeletal, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Testis, Thyroid, Whole_Blood