rs3764640 chr19:1207239 G>T
- Sequence
ttgctggggtcggggccgggccgg[G/T]ccagtcacggtgctgatggttctg
- ASB in cell types
- K562 (myelogenous leukemia) CD14+ monocytes CTV-1 (Adult T acute lymphoblastic leukemia)
- ASB for transcription factors
- STAT1_HUMAN SPI1_HUMAN RFOX2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| STAT1_HUMAN | 2.81 | -1.87 | 2.00 | n/a | No Hit | |||
| SPI1_HUMAN | 1.64 | -0.58 | 1.14 | n/a | No Hit | |||
| RFOX2_HUMAN | 1.73 | -1.03 | 2.00 | n/a | n/a |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GRASP adiponectin levels, alzheimers disease with psychotic symptoms (alzheimers disease with psychotic symptoms v. alzheimers disease without psychotic symptoms), alzheimers disease with psychotic symptoms (alzheimers disease with psychotic symptoms v. controls), diastolic blood pressure (dbp), eye color, neuroblastoma (brain cancer), paternal transmission distortion, systolic blood pressure (sbp), tetrology of fallot
PheWAS abnormal involuntary movements, abnormal papanicolaou smear of cervix and cervical hpv, abnormal reflex, allergy to serum or vaccine, alzheimers disease, anemia nos, ankylosing spondylitis, atrophy of edentulous alveolar ridge, benign neoplasm of unspecified sites, benign neoplasm of uterus, cardiac and circulatory congenital anomalies, cardiac congenital anomalies, cardiac shunt/ heart septal defect, cervical cancer and dysplasia, cervicocranial/cervicobrachial syndrome, claw toe, cns infection and poliomyelitis, diseases of hard tissues of teeth, diseases of the salivary glands, disorders of fluid, electrolyte, and acid-base balance, disturbances of sensation of smell and taste, eating disorder, electrolyte imbalance, fracture of lower limb, fracture of neck of femur, generalized hyperhidrosis, glycosuria or acetonuria, h. pylori, hypersomnia, hypopotassemia, immune disorders, influenza, irregular menstrual bleeding, keratoconjunctivitis sicca, kidney replaced by transpant, malunion fracture, myalgia and myositis nos, neuralgia, neuritis, and radiculitis nos, neutropenia, noninfectious disorders of lymphatic channels, nonrheumatic tricuspid valve disorders, nontoxic multinodular goiter, open wounds of head, neck, and trunk, osteoporosis, osteoporosis, nos or other, osteoporosis, osteopenia, & pathological fractures, other disorders of arteries and arterioles, other disorders of gallbladder, other open wound of head and face, other specified disorders of plasma protein metabolism, ovarian cyst, patellar fracture, peripheral retinal degenerations, personality disorders, photodermatitis & sunburn, plasma protein metabolism disorder, pneumonitis due to inhalation of food or vomitus, polyarthropathy or polyarthritis involving multiple sites nos, protein plasma/amino-acid transport and metabolism disorder, psoriatic arthropathy, sialoadenitis, skin neoplasm of uncertain behavior, sprains and strains, subarachnoid hemorrhage (injury), substance addiction and disorders, unspecified local infection of skin and subcutaneous tissue, urethritis and urethral syndrome, viral hepatitis, viral hepatitis c, visual field defects
GTEx eQTL Cells_Cultured_fibroblasts, Esophagus_Mucosa, Skin_Sun_Exposed_Lower_leg, Spleen, Whole_Blood