rs3764881 chrX:23743420 G>T
- Sequence
ttgtgcgggtcgtgttgctacagc[G/T]aggaccggcctattctcggttgag
- ASB for transcription factors
- ZFX_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ZFX_HUMAN | -1.66 | 2.30 | 2.00 | n/a | No Hit |
Items per page:
1 – 1 of 1