rs3764895 chr11:2924715 C>T
- Sequence
agggaagagactcagcccaatgcc[C/T]tgggaagcaccctgcatggctgag
- ASB in cell types
- breast tumor
- ASB for transcription factors
- ESR1_HUMAN PPARG_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ESR1_HUMAN | 2.74 | -5.07 | 2.00 | -3.91 | Concordant | |||
| PPARG_HUMAN | 1.66 | 0.00 | 1.00 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
Genetic associations
GRASP autism, obesity with early age of onset (age >2), prop taste detection threshold, serum creatinine
GTEx eQTL Adipose_Subcutaneous, Artery_Aorta, Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cortex, Brain_Frontal_Cortex_BA9, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Esophagus_Mucosa, Lung, Muscle_Skeletal, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid, Whole_Blood